bcl 2 (Bio-Rad)
Bio-Rad is a verified supplier 
Bio-Rad manufactures this product 
93
Structured Review
Bio-Rad
bcl 2
Bcl 2, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 93/100, based on 26 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+bcl+2/Mouse+anti+Human+Bcl-2/pmc13066449-263-3-4
Average 93 stars, based on 26 article reviews
Bcl 2, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 93/100, based on 26 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+bcl+2/Mouse+anti+Human+Bcl-2/pmc13066449-263-3-4
Average 93 stars, based on 26 article reviews
bcl 2 - by Bioz Stars,
2026-09
93/100 stars
Images
1) Product Images from "Conditional BCL-2 Expression in Fibroblasts Promotes Persistent Pulmonary Fibrosis which is Reversible by Therapeutic BCL-2 Inhibition"
Article Title: Conditional BCL-2 Expression in Fibroblasts Promotes Persistent Pulmonary Fibrosis which is Reversible by Therapeutic BCL-2 Inhibition
Journal: Nature Communications
doi: 10.1038/s41467-026-69865-4
Figure Legend Snippet: a Schematic of the human BCL-2 construct and CFP/BCL-2stop fl/+ mouse. b Primary lung fibroblasts from PDGFRα-CFP/BCL-2 + mice express hBCL-2 that co-localizes with Mitotracker Red (63X) ( n = 3 experimental replicates). Additional images show overlays of phalloidin and CFP (40X). By Western Blot, ( c ) fibroblasts from PDGFRα-CFP/BCL-2 + mice express CFP (detected with anti-GFP antibody) and BCL-2 which is located within ( d ) the mitochondrial fraction ( n = 3 experimental replicates). Caspase 3/7 activity in CFP/BCL-2 - and CFP/BCL-2 + fibroblasts after treatment with ( e ) staurosporine ( n = 9 experimental replicates, +/−SD, 2-tailed t test with Welch’s correction, *** p < 0.001) or ( f ) Jo2 +/- TNF-α/IFNγ ( n = 3 experimental replicates, +/-SD, 2-tailed t test with Welch’s correction, ** p < 0.01). g endogenous CFP expression (teal) in naïve lungs of PDGFRα-CFP/BCL-2 + mice co-immunostained BCL-2 (red) or with lineage cell markers (red or yellow) for PDGFRα, PDGFRβ, αSMA, proSPC, CCSP, CD45 and CD31 (20x). h Flow cytometry gating of PDGFRα and PDGFRβ populations from lineage negative cells (CD45 - /CD31 - /EpCAM - ). Broad PDGFRα + gating (pink gate) can be further sub populated into PDGFRα + only (CFP + , orange gate) and PDGFRα + /β + (CFP + , black gate). PDGFRβ + only pericytes (CFP -, red gate) are PDGFRα - . i Geometric mean of CFP expression in lineage sorted lung cell populations ( n = 4 mice/group, +/-SEM, 2-tailed t test with Welch’s correction, *** p < 0.001) and ( j ) flow cytometry histograms. CO = corn oil, Tamox = tamoxifen. Source data for c , d , e , f and i are provided as a Source Data file.
Techniques Used: Construct, Western Blot, Activity Assay, Expressing, Flow Cytometry
Figure Legend Snippet: a Schematic of in vivo tamoxifen or corn oil treatment of PDGFRα-CFP/BCL-2 fl/+ mice. b Immunofluorescent staining of PDGFRα (magenta), PDGFRβ (green) and TUNEL (white) in PDGFRα-CFP/BCL-2 - and PDGFRα-CFP/BCL-2 + mice 3 weeks after bleomycin. c Quantification of TUNEL + cells per high power field. Data is mean +/− SEM, n = 5. * p < 0.05, ** p < 0.01, *** p < 0.001. Brown–Forsythe and Welch’s ANOVA with Dunnett correction for multiple comparisons. Upper panels 20X, lower panels 40X. Source data for c is provided as a Source Data file.
Techniques Used: In Vivo, Staining, TUNEL Assay
Figure Legend Snippet: a Schematic of in vivo tamoxifen or corn oil treatment and time course of harvest in PDGFRα-CFP/BCL-2 fl/+ mice. b – d Quantification of PDGFRα + and PDGFRα + /β + fibroblasts and PDGFRβ + pericytes over time. e – g Frequency of CFP + PDGFRα + and PDGFRα + /β + fibroblasts and PDGFRβ + pericytes in PDGFRα-CFP/BCL-2 + mice after saline or bleomycin treatment. (h-i upper panels) CFP (teal), PDGFRα (magenta) and PDGFRβ (green) immunofluorescent staining of lungs over time after bleomycin in PDGFRα-CFP/BCL-2 - and PDGFRα-CFP/BCL-2 + mice. h – i lower panels) human BCL-2 (green) immunofluorescent staining of lungs over time after bleomycin in PDGFRα-CFP/BCL-2 - and PDGFRα-CFP/BCL-2 + mice. PDGFRα-CFP/BCL-2 + saline n = 4 mice/time point. PDGFRα-CFP/BCL-2 + bleomycin n = 5 mice/time point. PDGFRα-CFP/BCL-2 - saline n = 6 mice 0wk, 4 mice 3, 6, 12 wk, 5 mice 9 wk. PDGFRα-CFP/BCL-2 - bleomycin n = 5 mice/time point. Data is mean +/- SEM, Brown–Forsythe and Welch’s ANOVA with Dunnett correction for multiple comparisons * p < 0.05, ** p < 0.01, *** p < 0.001 compared to saline. # p < 0.05 9wk PDGFRα-CFP/BCL-2 + compared to other 9-week animals. ## p < 0.01, 6- and 12-week PDGFRα-CFP/BCL-2 + compared to other 6- and 12-week animals respectively. Upper panels 20X, lower panels 40X. Source data for b – g are provided as a Source Data file.
Techniques Used: In Vivo, Saline, Staining
Figure Legend Snippet: a Hydroxyproline levels in the lungs over time after bleomycin in PDGFRα-CFP/BCL-2 - and PDGFRα-CFP/BCL-2 + mice. PDGFRα-CFP/BCL-2 + saline n = 4 mice/time point. PDGFRαCFP/BCL-2 + bleomycin n = 5 mice/time point. PDGFRα-CFP/BCL-2 - saline n = 6 mice 0wk, 4 mice 3, 6, 12 wk, 5 mice 9 wk. PDGFRα-CFP/BCL-2 - bleomycin n = 5 mice/time point. Data is mean +/− SEM, ** p < 0.01, *** p < 0.001 3wk bleomycin compared to saline. ** p < 0.01 and *** p < 0.01 PDGFRα-CFP/BCL-2 compared to controls. 2-tailed t test with Welch’s correction. b Representative Trichrome stained lung sections over time in PDGFRα-CFP/BCL-2 + and PDGFRα-CFP/BCL-2 + mice. Blue arrows indicate cyst formation. c Quantitation of CCSP + KRT8 + and ( d ) SPC + cells per field over the time course. e Identification of CCSP + (magenta) and Krt8 + (green) transitional cells in saline or bleomycin at 0, 3, 6, 9 and 12 weeks after bleomycin in PDGFRα-CFP/BCL-2 + (upper) and PDGFRα-CFP/BCL-2 - (lower) lungs. f Identification of pro-SPC + (magenta) alveolar epithelial cells in PDGFRα-CFP/BCL-2 + (upper) and PDGFRα-CFP/BCL-2 - (lower) lungs. Aperio scans 2x. Immunofluorescence upper panels 20X, lower panels 40X. Source data for a, c and d are provided as a Source Data file.
Techniques Used: Saline, Staining, Quantitation Assay, Immunofluorescence
Figure Legend Snippet: a Dot plot representation of enriched Gene Ontology (GO) terms 3 weeks after bleomycin from PDGFRα-CFP/BCL-2 + fibroblasts compared to PDGFRα-CFP/BCL-2 - fibroblasts. b Differential gene expression associated with ECM organization ( c ) Box-and-whisker plots of ECM and pro-fibrotic genes expressed during non-resolving fibrosis in PDGFRα-CFP/BCL-2 + fibroblasts. Differential gene expression associated with ( d ) senescence regulation and ( e ) p53 signaling. f Box-and-whisker plots of key senescence and p53 associated genes in non-resolving PDGFRα-CFP/BCL-2 + fibroblasts. g Dot plot representation of enriched GO terms 6 weeks after bleomycin from PDGFRα-CFP/BCL-2 + fibroblasts compared to PDGFRα-CFP/BCL-2 - fibroblasts. Differential gene expression associated with ( h ) ECM disassembly and ( i ) box-and-whisker plots of genes expressed during resolving fibrosis in PDGFRα-CFP/BCL-2 - fibroblasts. Differential gene expression associated with ( j ) regulation of apoptotic signaling and ( k ) regulation of Wnt signaling in naïve, PDGFRα-CFP/BCL-2 - and PDGFRα-CFP/BCL-2 + fibroblasts. l Box-and-whisker plots of genes expressed during Wnt signaling in naïve, PDGFRα-CFP/BCL-2 - and PDGFRα-CFP/BCL-2 + fibroblasts. Heat maps generated with significant differentially expressed genes identified from GO BP pathways. c , f , i , l Box-and-whisker plots ( n = 4 biological replicates/group, mean; whiskers: min to max) are normalized TPM values with pAdj from DE analysis * p < 0.05, ** p < 0.01, *** p < 0.01. ECM, extracellular matrix. Avg NE = Average normalized expression. N Overlap = number of DEGs significantly expressed in the pathway. Source data for a – l are provided as a Source Data file.
Techniques Used: Gene Expression, Whisker Assay, Generated, Expressing
![a Heat maps of differential gene expression associated with regulation of cellular senescence in fibroblasts from PDGFRα-CFP/BCL-2 - and PDGFRα-CFP/BCL-2 + mice 6 weeks after bleomycin. b Senescence gene score ( n = 4 mice/group, mean +/− SEM, * p < 0.01, Brown–Forsythe and Welch’s ANOVA with Dunnett correction for multiple comparisons.) and ( c ) BCL-2 Pearson Correlation maps for 111 senescence associated genes in naïve, PDGFRα-CFP/BCL-2 - , PDGFRα-CFP/BCL-2 + fibroblasts. d – f Quantification of fibroblasts/field for p21, p16 and SA-β-gal from control and persistently fibrotic lungs from PDGFRα-CFP/BCL-2 - , PDGFRα-CFP/BCL-2 + mice ( n = 4 mice/group, mean +/− SEM of 10 individual images/mouse graphed as scatter plot with bar mean +/− SEM, *** p < 0.001, 2-tailed t test with Welch’s correction.). Immunofluorescence images for ( g ) PDGFRα (magenta) and PDGFRβ (green), ( h ) human BCL-2 (green), ( i ) p21 (yellow), ( j ) p16 (magenta) and ( k ) SA-β-gal (white). SA-β-gal, senescence associated-β-galactosidase. White arrow heads indicate shared features in serial sections. Spatial transcriptomic analysis of IPF lung. l H&E section ( m ) spatial map of cellular populations ( n ) BCL-2 expression map (red, individual transcripts) overlayed with myofibroblasts (yellow, cell boundaries) and ( o ) 10 gene senescence module ENV score. [A-C dotted line callouts are enlarged areas to show cell boundary, BCL-2 expression and senescence ENV score overlays]. p Heat maps of differential pro-fibrotic genes and senescence genes between BCL-2 + myofibroblasts and BCL-2 - myofibroblasts from the spatial transcriptomic data. q Myofibroblast cell counts between control IPF and BCL-2 + myofibroblast + counts from control and IPF spatial images (* p < 0.05 and *** p < 0.001, 2-tailed t test with Welch’s correction). r Quantification of α-SMA + myofibroblasts/field for BCL-2 in control and IPF lung sections (individual images graphed as scatter plot with bar mean +/- SEM, *** p < 0.001, 2-tailed t test with Welch’s correction). Immunofluorescent images of control and IPF lungs stained for ( s ) αSMA (magenta) and BCL-2 (green), ( t ) α-SMA (green) and p16 (magenta), ( u ) p21 (yellow), ( v ) SA-β-Gal (white). Images n = 5 subjects/group. Spatial transcript analysis n = 13 controls, n = 15 IPF Immunofluorescence panels 20X. 10 images/mouse for immunofluorescent quantitation. SA-β-gal, senescence associated-β-galactosidase. Cor coe = correlation coefficient. Source data are provided for a – f and p – r as a Source Data file.](https://pub-med-central-images-cdn.bioz.com/pub_med_central_ids_ending_with_6449/pmc13066449/pmc13066449__41467_2026_69865_Fig6_HTML.jpg "... with regulation of cellular senescence in fibroblasts from PDGFRα-CFP/BCL-2 - and PDGFRα-CFP/BCL-2 + mice 6 weeks after ...")
Figure Legend Snippet: a Heat maps of differential gene expression associated with regulation of cellular senescence in fibroblasts from PDGFRα-CFP/BCL-2 - and PDGFRα-CFP/BCL-2 + mice 6 weeks after bleomycin. b Senescence gene score ( n = 4 mice/group, mean +/− SEM, * p < 0.01, Brown–Forsythe and Welch’s ANOVA with Dunnett correction for multiple comparisons.) and ( c ) BCL-2 Pearson Correlation maps for 111 senescence associated genes in naïve, PDGFRα-CFP/BCL-2 - , PDGFRα-CFP/BCL-2 + fibroblasts. d – f Quantification of fibroblasts/field for p21, p16 and SA-β-gal from control and persistently fibrotic lungs from PDGFRα-CFP/BCL-2 - , PDGFRα-CFP/BCL-2 + mice ( n = 4 mice/group, mean +/− SEM of 10 individual images/mouse graphed as scatter plot with bar mean +/− SEM, *** p < 0.001, 2-tailed t test with Welch’s correction.). Immunofluorescence images for ( g ) PDGFRα (magenta) and PDGFRβ (green), ( h ) human BCL-2 (green), ( i ) p21 (yellow), ( j ) p16 (magenta) and ( k ) SA-β-gal (white). SA-β-gal, senescence associated-β-galactosidase. White arrow heads indicate shared features in serial sections. Spatial transcriptomic analysis of IPF lung. l H&E section ( m ) spatial map of cellular populations ( n ) BCL-2 expression map (red, individual transcripts) overlayed with myofibroblasts (yellow, cell boundaries) and ( o ) 10 gene senescence module ENV score. [A-C dotted line callouts are enlarged areas to show cell boundary, BCL-2 expression and senescence ENV score overlays]. p Heat maps of differential pro-fibrotic genes and senescence genes between BCL-2 + myofibroblasts and BCL-2 - myofibroblasts from the spatial transcriptomic data. q Myofibroblast cell counts between control IPF and BCL-2 + myofibroblast + counts from control and IPF spatial images (* p < 0.05 and *** p < 0.001, 2-tailed t test with Welch’s correction). r Quantification of α-SMA + myofibroblasts/field for BCL-2 in control and IPF lung sections (individual images graphed as scatter plot with bar mean +/- SEM, *** p < 0.001, 2-tailed t test with Welch’s correction). Immunofluorescent images of control and IPF lungs stained for ( s ) αSMA (magenta) and BCL-2 (green), ( t ) α-SMA (green) and p16 (magenta), ( u ) p21 (yellow), ( v ) SA-β-Gal (white). Images n = 5 subjects/group. Spatial transcript analysis n = 13 controls, n = 15 IPF Immunofluorescence panels 20X. 10 images/mouse for immunofluorescent quantitation. SA-β-gal, senescence associated-β-galactosidase. Cor coe = correlation coefficient. Source data are provided for a – f and p – r as a Source Data file.
Techniques Used: Gene Expression, Control, Immunofluorescence, Expressing, Staining, Quantitation Assay
Figure Legend Snippet: a Heat maps of differential gene expression associated with regulation of cellular senescence in fibroblasts from two non-resolving models of fibrosis; repetitive bleomycin and Col1a1-Fas -/- . b Quantitative senescence Z-score and ( n = 4 mice/group, mean +/- SEM, ** p < 0.01, Brown-Forsythe and Welch’s ANOVA with Dunnett correction for multiple comparisons.) c Bcl-2 Pearson Correlation maps for senescence associated genes ( p < 0.05) in repetitive bleomycin and Col1a1-Fas -/- fibroblasts. Immunofluorescent images and quantitation of fibroblasts/per field from control and persistently fibrotic lungs from repetitive bleomycin and Col1a1-Fas -/- mice for ( d ) PDGFRα (magenta) and PDGFRβ (green), ( e ) murine Bcl-2 (green), ( f ) p21 (yellow), ( g ) p16 (magenta) and ( h ) SA-β-Gal (white). d – h 5 mice/group; individual images graphed as scatter plot with bar mean + /-SEM, * p < 0.05, *** p < 0.001 Brown–Forsythe and Welch’s ANOVA with Dunnett correction for multiple comparisons. Immunofluorescence panels 20X. SA-β-gal, senescence associated-β-galactosidase. Avg NE = Average normalized expression. Cor coe = correlation coefficient. nsd = no significant difference. Source data are for a – c and e – h provided as a Source Data file. Data for Col1a1-Fas -/- fibroblasts (GEO: GSE161648 ) were previously published 11 .
Techniques Used: Gene Expression, Quantitation Assay, Control, Immunofluorescence, Expressing
Figure Legend Snippet: a Schematic of fibrosis induction and therapeutic dosing schedule with ABT-199. b Hydroxyproline content of lungs at 9 weeks, ( c – d ) Quantification of PDGFRα + fibroblasts and PDGFRβ + pericytes. e representative axial images (red overlay indicates disease area) and ( f ) 3D reconstructions (non-aerated fibrotic lung in blue, aerated lung in gray). g arterial oxygen saturation and ( h ) quantified non-aerated lung volume measured by micro-CT. i Representative Trichrome stained lung sections and semi-quantitative histology scoring after vehicle or ABT-199 treatment. b – i n = 5 mice/group, time-course line graphs mean +/− SEM. * p < 0.05, ** p < 0.01, *** p < 0.001, Brown–Forsythe and Welch’s ANOVA with Dunnett correction for multiple comparisons). j – k Representative immunofluorescent staining and quantitation of fibroblasts/per field in vehicle and ABT-199 treated PDGFRα-CFP/BCL-2 + mice for p21 (yellow), p16 (magenta) and SA-β-gal (white). Aperio scans 2x, panels 10x. Immunofluorescence panels 20X. n = 5 mice/group; individual images graphed as scatter plot with bar mean + /−SEM, * p < 0.05, ** p < 0.01, *** p < 0.001, Brown–Forsythe and Welch’s ANOVA with Dunnett correction for multiple comparisons. Source data for b – d , g , h and j are provided as a Source Data file.
Techniques Used: Micro-CT, Staining, Quantitation Assay, Immunofluorescence
Related Articles
Sequencing:Article Title: Mechanism of total saponins of Ranunculus ternatus Thunb. in treatment of breast cancer based on liquid chromatography–mass spectrometry and network analysis Article Snippet: .. The following supplies were used: Eleutheroside A standard (Chengdu Pusi Biotechnology; PS0811-0025); R. ternatus Thunb.plant medicine (Xinyang, Henan Province); a mouse IL-6 kit (Suzhou Calvin Biotechnology CK-E20012M); a mouse TNF-α kit (CK-E20220M); a mouse IL-10 kit (CK-E20206M); a human IL-6 kit (Suzhou Calvin Biotechnology Co., Ltd.; CK-E20665M); a human TNF-α kit (CK-E20036M); a human IL-10 kit (CK-E20667M); fetal bovine serum (Ausbian; S711-001S); RPMI-1640 basic medium with dual antibiotics (Wuhan Procell Life Science & Technology; PM150110A); rabbit anti-Bax primary antibody (Beijing Bioss; bs-0127R); rabbit anti-Bcl-2 primary antibody (Beijing Bioss; bs-4563R); rabbit GAPDH (GAPDH; Wuhan Sanying Biotechnology; GB-15004); rabbit anti-p-JAK2 primary antibody (Bioss; bs-3206R); Goat Anti-Rabbit IgG H&L antibody (Bioss; bs-40295G-IRDye800CW); primer sequence information 5′–3′ primer sequence: Mouse GAPDH (Forward: CCT CGT CCC GTA GAC AAA ATG, Reverse: TGA GGT CAA TGA AGG GGT CGT); Mouse JAK2 (Forward: GTG CTT TTG AAG ACA GGG ACC, Reverse: GGG TCA TAG CGG CAC ATC TC); MouseSTAT3(Forward:TGCGGAGAAGCATTGTGAGTG, Reverse: TCT TAA TTT GTT GGC GGG TCT); Human GAPDH (Forward: GGA AGC TTG TCA TCA ATG GAA ATC, Reverse: TGA TGA CCC TTT TGG CTC CC); Human JAK2 (Forward: GGC CTT CTT TCA GAG CCA TCA, Reverse: TTT TAC AGC GAC CAC CTC CC); Human STAT3 (Forward: CTC AAC TAT CTG GAG GAC AAA GGC, Reverse: TGA CGC CAC TAA ACA CTT CCC); Human Bax (Forward: CGG GTT GTC GCC CTT TTC TA, Reverse: GAG GAA GTC CAA TGT CCA GCC); Countercurrent Chromatography:Article Title: Mechanism of total saponins of Ranunculus ternatus Thunb. in treatment of breast cancer based on liquid chromatography–mass spectrometry and network analysis Article Snippet: .. The following supplies were used: Eleutheroside A standard (Chengdu Pusi Biotechnology; PS0811-0025); R. ternatus Thunb.plant medicine (Xinyang, Henan Province); a mouse IL-6 kit (Suzhou Calvin Biotechnology CK-E20012M); a mouse TNF-α kit (CK-E20220M); a mouse IL-10 kit (CK-E20206M); a human IL-6 kit (Suzhou Calvin Biotechnology Co., Ltd.; CK-E20665M); a human TNF-α kit (CK-E20036M); a human IL-10 kit (CK-E20667M); fetal bovine serum (Ausbian; S711-001S); RPMI-1640 basic medium with dual antibiotics (Wuhan Procell Life Science & Technology; PM150110A); rabbit anti-Bax primary antibody (Beijing Bioss; bs-0127R); rabbit anti-Bcl-2 primary antibody (Beijing Bioss; bs-4563R); rabbit GAPDH (GAPDH; Wuhan Sanying Biotechnology; GB-15004); rabbit anti-p-JAK2 primary antibody (Bioss; bs-3206R); Goat Anti-Rabbit IgG H&L antibody (Bioss; bs-40295G-IRDye800CW); primer sequence information 5′–3′ primer sequence: Mouse GAPDH (Forward: CCT CGT CCC GTA GAC AAA ATG, Reverse: TGA GGT CAA TGA AGG GGT CGT); Mouse JAK2 (Forward: GTG CTT TTG AAG ACA GGG ACC, Reverse: GGG TCA TAG CGG CAC ATC TC); MouseSTAT3(Forward:TGCGGAGAAGCATTGTGAGTG, Reverse: TCT TAA TTT GTT GGC GGG TCT); Human GAPDH (Forward: GGA AGC TTG TCA TCA ATG GAA ATC, Reverse: TGA TGA CCC TTT TGG CTC CC); Human JAK2 (Forward: GGC CTT CTT TCA GAG CCA TCA, Reverse: TTT TAC AGC GAC CAC CTC CC); Human STAT3 (Forward: CTC AAC TAT CTG GAG GAC AAA GGC, Reverse: TGA CGC CAC TAA ACA CTT CCC); Human Bax (Forward: CGG GTT GTC GCC CTT TTC TA, Reverse: GAG GAA GTC CAA TGT CCA GCC); Saline:Article Title: Photo-Triggered Delivery of siRNA and Paclitaxel into Breast Cancer Cells Using Catanionic Vesicles. Article Snippet: Localized drug delivery holds great promise as a means of circumventing traditional chemotherapy side effects associated with high toxicity and prolonged treatments.. Nanosized carriers (i.e., with diameters <100 nm) can often accumulate in tumor cells, yet it remains a challenge to design such carriers that are at the same time durable (to survive delivery) and degradable (to release the payload once inside cells).. In the present study, photoresponsive catanionic vesicles are utilized to codeliver Bcl-2 siRNA and paclitaxel into MDA-MB-231 human breast cancer cells. Incubation:Article Title: Photo-Triggered Delivery of siRNA and Paclitaxel into Breast Cancer Cells Using Catanionic Vesicles. Article Snippet: Localized drug delivery holds great promise as a means of circumventing traditional chemotherapy side effects associated with high toxicity and prolonged treatments.. Nanosized carriers (i.e., with diameters <100 nm) can often accumulate in tumor cells, yet it remains a challenge to design such carriers that are at the same time durable (to survive delivery) and degradable (to release the payload once inside cells).. In the present study, photoresponsive catanionic vesicles are utilized to codeliver Bcl-2 siRNA and paclitaxel into MDA-MB-231 human breast cancer cells. |
